crispr guide rna design tool (Benchling Inc)
86
Structured Review
Benchling Inc
crispr guide rna design tool
Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+tool/crispr+design+tool/pmc13155868-62-34-40
Average 86 stars, based on 1 article reviews
Crispr Guide Rna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+design+tool/crispr+design+tool/pmc13155868-62-34-40
Average 86 stars, based on 1 article reviews
crispr guide rna design tool - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
Cloning:Article Title: Saturation editing of RNU4-2 reveals distinct dominant and recessive disorders. Article Snippet: .. Single guide RNA design and cloning The gRNA used for SGE was designed using Benchling’s CRISPR:Article Title: Saturation editing of RNU4-2 reveals distinct dominant and recessive disorders. Article Snippet: .. Single guide RNA design and cloning The gRNA used for SGE was designed using Benchling’s Article Title: Phorbol Myristate Acetate Inhibits Senecavirus A Replication by Activating IKBKE–Mediated IFN Pathway and NF‐κB Signal Article Snippet: .. Three sgRNA sequences were designed using an online Article Title: PD‐L1‐Binding Antigen Presenters: Redirecting Vaccine‐Induced Antibodies for Cancer Immunotherapy Article Snippet: .. The sgRNA sequences targeting mouse (sgRNA: GTATGGCAG‐CAACGTCACGA) and human PD‐L1 (sgRNA: ACCGTTCAGCAAATGCCAGT)were designed using the online Article Title: A repressive regulatory cascade shapes temporal patterning of activity-regulated gene expression in a defined sensory neuron type Article Snippet: .. crRNAs, tracrRNAs and Cas9 protein were obtained from Integrated DNA Technologies (IDT). crRNAs were designed using Benchling’s built in Article Title: PD-L1-Binding Antigen Presenters: Redirecting Vaccine-Induced Antibodies for Cancer Immunotherapy. Article Snippet: .. The sgRNA sequences targeting mouse (sgRNA: GTATGGCAG-CAACGTCACGA) and human PD-L1 (sgRNA: ACCGTTCAGCAAATGCCAGT)were designed using the online Article Title: The lysosomal LAMTOR-Rag complex functions as a checkpoint for antiviral interferon production Article Snippet: CRISPR-Cas9-mediated knockout cell line generation was performed using pLentiCRISPRv2-GFP-puro, a construct modified from pLentiCRISPRv2-puro (Addgene #52961). .. Small guide RNAs (sgRNAs) were selected using the Article Title: Pmel17 Deficiency Affects Melanogenesis and Promotes Tumor Vascularization Article Snippet: .. The single guide RNA (sgRNA) was designed using Benchling’s Sequencing:Article Title: Saturation editing of RNU4-2 reveals distinct dominant and recessive disorders. Article Snippet: .. Single guide RNA design and cloning The gRNA used for SGE was designed using Benchling’s Transfection:Article Title: PD‐L1‐Binding Antigen Presenters: Redirecting Vaccine‐Induced Antibodies for Cancer Immunotherapy Article Snippet: .. The sgRNA sequences targeting mouse (sgRNA: GTATGGCAG‐CAACGTCACGA) and human PD‐L1 (sgRNA: ACCGTTCAGCAAATGCCAGT)were designed using the online Article Title: PD-L1-Binding Antigen Presenters: Redirecting Vaccine-Induced Antibodies for Cancer Immunotherapy. Article Snippet: .. The sgRNA sequences targeting mouse (sgRNA: GTATGGCAG-CAACGTCACGA) and human PD-L1 (sgRNA: ACCGTTCAGCAAATGCCAGT)were designed using the online Multiple Displacement Amplification:Article Title: PD‐L1‐Binding Antigen Presenters: Redirecting Vaccine‐Induced Antibodies for Cancer Immunotherapy Article Snippet: .. The sgRNA sequences targeting mouse (sgRNA: GTATGGCAG‐CAACGTCACGA) and human PD‐L1 (sgRNA: ACCGTTCAGCAAATGCCAGT)were designed using the online Article Title: PD-L1-Binding Antigen Presenters: Redirecting Vaccine-Induced Antibodies for Cancer Immunotherapy. Article Snippet: .. The sgRNA sequences targeting mouse (sgRNA: GTATGGCAG-CAACGTCACGA) and human PD-L1 (sgRNA: ACCGTTCAGCAAATGCCAGT)were designed using the online other:Article Title: Pmel17 Deficiency Affects Melanogenesis and Promotes Tumor Vascularization. Article Snippet: The B16F10 murine melanoma cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). |